Night Flash

My one and always

Pearl with snobear

Zainab

BOLAVITA Situs Slot Deposit Seabank Online 24Jam

Link Daftar Situs Slot Deposit Bank Seabank Online 24Jam : https://tinyurl.com/daftarslotdisini

The devil is mine.

Fire Immortal

Countless years have passed since the inception of the Dao and the myriad worlds have given birth to billions upon billions of lifeforms have sought out their own "Truth". Confucianism preached a tranquility between oneself and others, the Golden Rule as well as the perpetual fluctuations between Yin and Yang. Taoism sought out "The Way", a metaphysical force which encompasses all of creation, binding and releasing things that go with the Way. Buddhism desired to understand the nature of suffering, and the cessation of suffering in order to achieve Nirvana. The school of Yin-Yang created the law of Five-Elements as well as the complimentary nature of yin and yang. Taiji wanted to reach the "Supreme Ultimate", the movement of yang and the tranquility of yin. However with the progression of the Dao and the ceaseless natural evolution of the myriad worlds, as well as the myriad races that reside within them, the Dao has been forgotten, and the path to the "Truth" lost. A rainbow meteor shower glistens in the night sky and a young man looks up and his fate changed. The path is now clear.

Weird things that have happened to me

SERVANTS QUEST

My Wife is a Superstar

The leader wants to give his daughter who is a big star to marry me ...... But I do not want to eat soft rice how to do?

The Island of Bewitched

Kathrine Kent is socially awkward, bisexual girl, who accidentally gets sucked up into the world of magic, mist and opportunities. There she finally makes true friends, falls deeply in love and discovers her true potential.

Webnovel the most prestigious web competition

My poor ex-boyfriend becomes a billionaire!

Lily's life turned upside down (it literally did) when she found herself in a a love revenge novel ,she read months before she died. In the novel the female lead was a spoiled rotten ,daddy's princess. She toyed with the male protagonist's feelings just because she could. While reading the novel Lily had cursed the female lead many times but now lily shuddered from thinking about the female lead's ending..... _____ Ethan POV: She's so going to regret what she did and I'll make sure she does ..I will toy her the same way she toyed with me years back. ______ Lily's POV: The one you are looking for is already dead ,please spare me. I'm only a pitiful soul who had to live in her body wuwuwu _______ Authors note:*English is my second language so please bear with me**The cover is not mine ,found it on pinterest*

Segret and the secret of hogwarts

Life of Shi

??????????Question mark???????

Saiko No Jittai

Sam, Mia, Ben, Adam, Sara, Joseph, ezra, Sheila, luna

Twisted 11 : 11

In which a girl makes a wish at 11:11 p.m. but her wishes turns out to be the opposite.

el quinto hijo de la familia fénix

The War of Two

The Lost Children

Azarashi Tales

My first project is in a fantasy world were the world is at peace but soon the "cursed children" appears the sign of the rise of demons is here . The main character will be one of those cursed children trying to survive . Only at 10 years old he is sent to the East by the church alongside others cursed children to get killed at the border. If you want more information go check the chapter 0

Whispers Whispers

vihcgicgicugcugcgucfucufcugcugcugcgucguccgucgucgicjgcgicgicgucigcgicgu

Un amor por accidente

Cursed Heroes

Four young adults applied for a job as beta testers on the newest AR technology, and got selected to do the job in which they'll test a game using the AR Gear. Everything is beautiful till they find out that reality is often disappointing, and, what seems like just a testing job, becomes more than that.

Myriad Realms Grand Manager with a God Class System (Retranslated)

There are chewing gums that can be chewed in your mouth and continuously provide energy, there are sodas that can bring you back to the life from verge of demise.There are warehouses full of sacred animals and powerful artifacts. Countless powerful people gathered to enter in the store, and the powerful ministers and emperors comes in line, but they can only wait outside. Because the store manager Qi Le will definitely open the door on time. "What? For these free guys, let me lose one minute of sleep? Impossible!" Qi Le said.. ------------------------------------------------------------------- This is my personal edit of the Myriad Realms Grand Manager with a God Class System novel. Please support the original translator of this novel. https://www.patreon.com/Tempestpanda ------------------------------------------------------------------- Disclaimer I don't own the cover photo nor it's copyright.

Fate made Me Lonely

Nuan a 20 years old girl is very enthusastic and lovable person. she facing somany encounters in her life. she overcome those obstacles ? Will her brother recover? Will she get her love back?Who is going to be her life partner?

Modification

James is struggling to get by for the sake of his little sister until he's fired but the a man approached him and asked him a simple question... Please Read Chapter 1 for the rest

Protector of the Fairies

Not mine Fanfiction

Black Rings

War is not something native to Earth. It is a language spoken across the galaxy. It entices those who seek power and beckons others to destroy it. It is a cycle. One that has broken many times, and reshaped how even the smallest species saw reality. It is time for the cycle to break once more, and for Earth to get a taste of what war really looks like.

Indian Escorts in Palm Jumeirah +971525382202 Escort Service

Indian Escorts in Palm Jumeirah +971525382202 Escort Service in Palm Jumeirah By Independent Escort Girls in Palm Jumeirah UAE Call/Whatsapp:- +971509530047 Escort in Dubai indian Escort Girls in Dubai dubai Escort, pakistani Escort in Dubai cheap Escort Girls in Dubai filipino Escort Girls in Dubai russian Escort Girls Girls in Dubai Escort Girls in bur Dubai dubai Escort number, mallu Escort Girls Girls in Dubai Escort in deira Dubai philippines Escort Girls in Dubai Escort Girls philippines in Dubai dubai tamil Escort kerala Escort in bur Dubai deira dubai Escort, Escort Girls imo number in Dubai dubai Escort no, Escort Girls in dubai whatsapp number, dubai hot Escort, arab Escort in Dubai Escort in al nahda Dubai china Escort Girls in Dubai dubai Escort rate, dubai Escort Girls skype id, dubai girl call, filipino Escort Girls in bur Dubai srilankan Escort in Dubai 24 7 call.girls in Dubai acterss Escort in dubai standard, africal Escort in Dubai african Escort Girls in Dubai andhra aunty Escort Dubai asian Escort Girls Dubai asian sexy Escort in Dubai assian Escort Girls Dubai assian Escort Girls in Dubai aunty Escort Dubai bangladesh Escort Girls in Dubai bella bbw Escort in Dubai bella Escort Girls in dubai bella milf Escort in Dubai bengali Escort in Dubaibur dubai Escort Girls Escort Girls for sex in Dubai Escort in dera Dubai Escort Girls in dubai contact, Escort in dubai no agent, Escort Girls Girls in marina Dubai Escort Girls malayalam number in Dubai Escort Girls pics model Dubai Escort rate in bur Dubai Escort what's app mobile number in Dubai Escort club in Dubai Escort Girls contact Dubai Escort Girls contact in Dubai Escort dubai deira, Escort Girls in broadway hotel Dubai Escort in bur dubai hotels, Escort Girls in dubai 500 aed, Escort in dubai bar, Escort in dubai international city, Escort in international city Dubai Escort Girls Girls in salaudin street Dubai Escort Girls in silicon oasis Dubai Escort in union Dubai

Fun house

the girl from another world

Living in DC With Marvel Power's

This is not a serious story just a Wish-FulFillment and only made it cause I am bored. people seem to be misunderstanding the wishes of the Mc, he as sentry power's with the cosmic control rod boosting those powers immensely,Simmilar to how it made Franklin X-gene stronger.

Hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhj

Ayesha Clemira

Perkenalkan namaku Ayesha Clemira biasa dipanggil “Cle” aku berumur 23 tahun dan aku mengabdikan diriku beberapa bulan ini untuk mengajar di sebuah desa yang bisa terbilang terpencil dimana aku dipaksa untuk mandiri dan jauh dari orang tua. Hidupku berubah setelah kedatangan sesosok dokter nyebelin di desa tempatku mengabdi. “Cle kamu duduk di depan aja gpp, ntar kamu mabuk lagi” tawar Ara, “kamu aja deh Ra, aku di belakang aja bareng ibu-ibu” tolakku seadanya Akhirnya kami pulang setelah sekian lama menunggu aktivitas belanja para ibu-ibu, walaupun dengan beberapa dramanya yang berebutan untuk menumpang di mobil Ziyan. Bermacam-macam bau mengeluarkan aromanya, seolah menusuk berdesakan masuk kehidungku. Perutku menolak dan memuntahkannya. “wueeek . . . wueeek . . . wueek” ku keluarkan semua sarapan ku pagi ini beriringan dengan bau yang ku cium “kamuuu !!!” teriak Ziyan, mukanya merah padam menahan amarah Trauma itu masih terngiang-ngiang dibenakku, aku dipaksa menyetir sendiri lagi. Aku yang takut akan kejadian serupa terulang kembali kejadian yang sukses mengelabui pikiran ku agar tak membawa mobil lagi. Cukup satu korban yang sampai saat ini pun masih membuatku merasa bersalah

headcanons

Veronica, Dia Si Musuh Wanita (SELESAI)

Runa tidak pernah menyangka, kehidupan SMA-nya yang biasa harus berubah menjadi luar biasa ketika ia dinikahkan dengan Rafael Dafano. Uuuuuurrrgghh!!! Cowok playboy, rese, nyebelin! Sialnya dia pinter plus cakep. Pernikahan yang dirahasiakan juga hubungan yang tidak pernah damai. Belum lagi perjanjian konyol yang mereka buat. Rafael yang awalnya tidak suka dengan Runa, sah-sah saja dengan perjanjian itu. Sampai akhirnya sosok Geo datang, kenapa Rafael rasanya ingin merobek perjanjian sialan itu, ya? ig : @midori_tringo (yang mau bertanya, atau mengobrol, akses aja ke sini ya :D)